|
|
|
| | | | | | | | | | Welcome! Login |
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | int(10) unsigned | NO | PRI | auto_increment | internal identifier | ||
| accesstime | datetime | NO | 0000-00-00 00:00:00 | time stamp of login | |||
| ip_address | char(20) | NO | 0.0.0.0 | Internet protocol address |
AvgMethod
Comment:
Should be deprecated. Used by ProbeSetFreeze (March 2016 by RWW)
A table that simply lists the transformations used to generate microarray probe or probe set data. For example, for the Affymetrix platform MAS5, PDNN, RMA, are common transformation methods. For Illumina, the transform methods included Rank, RankInv, LOESS, LOESS_NB (no background). A single raw data set can be transformed in several ways, giving rise to a family of related data sets. This table was originally set up by Jintao Wang. We should confirm that this table is still used. Possibly a development vestige. "mlratio" was added by Evan Williams June 2008 to describe the Agilent "mean log" method used by Lusis and colleagues.
The table is referenced in ProbeSetFreeze, so it is still in use on Dec 14,2006. 6 records on Dec14, 2006. ID12065
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | internal identifier | ||
| AvgMethodId | int(5) | YES | |||||
| Name | char(30) | NO | name or abbreviation of the method used to generate the probe set consensus estimates of transcript abundance | ||||
| Normalization | varchar(30) | YES |
BXDSnpPosition
Comment:
PLEASE CORRECT TALBE AND FIELD NAMES. A table created by Hongqiang (October 2007) to be used to display SNPs on the interval maps for all crosses of mice including BXD, AXB, AKXD and B6D2F2 mouse crosses. Field are not well annotated. All data in this table is taken from the main mouse SNP table. This table should be refreshed every day or week. Hongqiang would need to write a script to do this. Not done yet (Nov 13, 2007). Reviewed by Kev and Rob, July 2008. Evan may have used this table to get SNPs to show up on the BHF2 interval maps. Still needs to be renamed. Needs to handle CXB RI set and LXS RI set.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | int(11) | NO | PRI | auto_increment | |||
| Chr | char(2) | YES | MUL | Chromosome | |||
| StrainId1 | int(11) | YES | Not sure, Strain identifier (probably C57BL/6J) | ||||
| StrainId2 | int(11) | YES | Not sure, Strain identifier (probably DBA/2J | ||||
| Mb | double | YES | SNP position in megabases rather than basepairs from mm8. Is this really mm8. Should be mm9 up to Mar 2016. | ||||
| Mb_2016 | double | YES |
CaseAttribute
Comment:
This is a new table created by Zach Sloan and Lei Yan in 2014-2015 to allow us to add cofactors and metadata that typically display in the Trait Data and Analysis page along side of the phenotype values for each case/sample. For example, if you review any of the human data sets where GROUP = "Brain, Development: Normal Gene Expression (Yale/Sestan)" you will find CaseAttribute data for the expression data sets such as Sex, PostMortem Interval (PMI), Age, Ethnicity, Tissue, pH.
This table may not really be necessary, since all data here could also be put into the Phenotype data table. But then we need code that would allow the user (or programmer or annotator) to decide what cofactors to show in the Trait Data and Analysis page.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | |||
| Name | varchar(30) | NO | The name of the cofactor shown in the Trait Data and Analysis page (e.g. "Ethn.", "pH", "Sex") | ||||
| Description | varchar(250) | YES |
CaseAttributeXRef
Comment:
Table used for handle database metadata. One to one mapping for ProbeSetFreeze etc.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| ProbeSetFreezeId | smallint(5) unsigned | NO | PRI | 0 | |||
| StrainId | smallint(5) unsigned | NO | PRI | 0 | |||
| CaseAttributeId | smallint(5) | NO | PRI | 0 | |||
| Value | varchar(100) | NO |
CaseAttributeXRefNew
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(11) | NO | UNI | auto_increment | |||
| InbredSetId | smallint(5) unsigned | NO | PRI | 0 | |||
| StrainId | int(8) unsigned | NO | PRI | 0 | |||
| CaseAttributeId | smallint(5) | NO | PRI | 0 | |||
| Value | varchar(100) | NO |
CeleraINFO_mm6
Comment:
PLEASE DELETE: DEPRECATED: use the Snp table instead.
CeleraINFO_mm6 provides information on single nucelotide polymorphisms (SNPs) for five strains of mice, C57BL/6J, DBA/2J, A/J, 129S1/SvImJ, and 129X1/SvJ, obtained from Celera Genomics by Alex Williams and Chris Vincent, summer 2003.
"mm6" refers to the megabase positions taken from the sixth build of Mus musculus as presented in UCSC Genome Browser (also known as NCBI Mouse Build 34 that was current from March 2005 through approximately March 2006).
mm6 data were generated by Yanhua Qu by BLAT sequence alignment of ~300 bp of sequence around each SNP. This table was generated by Robert Crowell and Yanhua Qu, June 2005, for use on WebQTL physical maps.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(10) unsigned | NO | PRI | auto_increment | |||
| SNPID | char(14) | NO | MUL | from Celera Genomics | |||
| chromosome | char(3) | YES | MUL | mouse chromosome from BLAT alignment | |||
| MB_UCSC | double | YES | MUL | mouse mm6 position in megabases from the UCSC Genome Brower mm6 BLAT analysis (NCBI Build 34) | |||
| MB_celera | double | YES | megabase position given by Celera | ||||
| allele_B6 | char(4) | YES | the allele of C57BL/6J | ||||
| allele_D2 | char(4) | YES | the allele of DBA/2J | ||||
| allele_AJ | char(4) | YES | the allele of A/J | ||||
| B6_D2 | char(1) | YES | a flag (0 or 1) that denotes if B6 and D2 have ths same allele (0) or a different allele (1) that is used in generating SNP tracks on BXD physical maps | ||||
| B6_AJ | char(1) | YES | same as above but used for the AXB/BXA cross | ||||
| D2_AJ | char(1) | YES | same as above | ||||
| MB_UCSC_OLD | double | YES | the mm5 position values | ||||
| allele_S1 | char(4) | YES | |||||
| allele_X1 | char(4) | YES | |||||
| flanking5 | char(100) | YES | |||||
| flanking3 | char(100) | YES |
Chr_Length
Comment:
This table provides the approximate length of a chromosome in megabases taken from the most recent public genome assemblies of several species. As of Aug. 2005, this table contains lengths for mouse, rat, and Arabidopsis chromosomes. No data for Barley since there is not physical assembly yet. We are usually missing the Y chromosome and the mitochondrial genome (Chr Y and Chr M, respectively).
Some of these fields should be semantically registered (SpeciesId, Chromosome_name).
Created by Jintao Wang, 2004.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Name | char(3) | NO | At most 3 letter name of the chromosome ID1206 | ||||
| SpeciesId | smallint(5) unsigned | NO | PRI | 0 | Species.Id | the identifier for the species. This may be the official NCBI species code or just an internal GN code. Check | |
| OrderId | smallint(5) unsigned | NO | PRI | the numerical order of chromosomes for purposes of generating whole genome maps (Chr X is 20 in mouse) | |||
| Length | int(10) unsigned | NO | 0 | the length of the chromosome in megabase units | |||
| Length_2016 | int(10) unsigned | NO | 0 | ||||
| Length_mm8 | int(10) unsigned | YES |
DatasetMapInvestigator
Comment:
Dataset owner or creator. Not sure how this is used? Is it used to for data access or password control? Check with Arthur Centeno or Lei Yan if this is used to define private ProbeSetFreeze (RWW Mar 2016). Probably created by Arthur Centeno 2014-2015. Why is the word "Map" in the table name?
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | mediumint(9) | NO | PRI | auto_increment | |||
| DatasetId | int(6) | NO | |||||
| InvestigatorId | int(6) | NO |
DatasetStatus
Comment:
This is the private versus public flag for a large molecular phenotype data sets (aka prior to 2016 as a ProbeSetFreeze) (RWW March 2016). This table probably created by Arthur Centeno in 2014-2015.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| DatasetStatusId | int(5) | NO | PRI | ||||
| DatasetStatusName | varchar(20) | YES |
Dataset_mbat
Comment:
DEPRECATED. What is mbat? Is this associated with 8 tissues and phenotypes of BXD only. Hippocampus, brain, cerebellum, eye, neocortex, NAc, PFC, striatum and phenotypes. All before 2008. (RWW Mar 2016)
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | int(11) | NO | PRI | auto_increment | |||
| switch | int(1) | YES | |||||
| species | varchar(255) | YES | |||||
| cross | varchar(255) | YES | |||||
| tissue | varchar(255) | YES | |||||
| database | varchar(255) | YES | |||||
| database_LongName | varchar(255) | YES |
Datasets
Comment:
DEPRECATED in favor of "InfoFiles". Check if this is still needed (March 2016). These are the annotation/metadata fields used to describe molecular phenotypes only (aka ProbeSetFreezes). This table designed by Arthur Centeno and used to generate and modify "INFO" tables. Created in 2014-2015.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| DatasetId | int(6) | NO | PRI | auto_increment | |||
| ProbeFreezeId | int(8) | YES | |||||
| DatasetName | varchar(255) | YES | |||||
| GeoSeries | varchar(30) | YES | |||||
| PublicationTitle | longtext | YES | |||||
| Summary | longtext | YES | |||||
| ExperimentDesign | longtext | YES | |||||
| AboutCases | longtext | YES | |||||
| AboutTissue | longtext | YES | |||||
| AboutPlatform | longtext | YES | |||||
| AboutDataProcessing | longtext | YES | |||||
| Contributors | longtext | YES | |||||
| Citation | longtext | YES | |||||
| Acknowledgment | longtext | YES | |||||
| Notes | longtext | YES | |||||
| InvestigatorId | int(5) | NO | |||||
| DatasetStatusId | int(5) | NO |
Docs
Comment:
Rob suspects that this table is used to track images, PDF, etc, that are uploaded into GN documentation (e.g., References and Glossary). Check with Arthur or Lei. (RWW March 2016)
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | int(11) | NO | PRI | auto_increment | |||
| entry | varchar(255) | NO | |||||
| title | varchar(255) | NO | |||||
| content | text | NO |
EnsemblChip
Comment:
Deprecated and not a function in GN2. For that matter, not even a function of most array data in GN1. One of several tables created by Hongqiang Li to be used with Probe Tool functions for M430 Affymetrix array to show location of probes only in mouse. All locations are equivalent to mm8 in mouse. Xusheng Wang points out that this could be done from UCSC browser.
This table should also be updated at some point.
Probe locations were obtained from Ensembl ftp://ftp.ensembl.org/pub/current_mus_musculus/data/mysql/mus_musculus_core_43 by Hongqiang Li. We made use of text files and MySQL tables called:
oligo_feature.txt.table.gz (25774 KB file of 3/1/07 1:53:00 AM)
oligo_probe.txt.table.gz (24411 KB 3/1/07 1:54:00 AM)
seq_region.txt.table.gz (383 KB, 3/1/07 1:59:00 AM)
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(11) | NO | PRI | ||||
| ProbeSetSize | int(11) | NO | |||||
| Name | varchar(40) | NO | |||||
| Type | enum('AFFY','OLIGO') | YES |
EnsemblProbe
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(11) | NO | MUL | ||||
| ChipId | int(11) | NO | |||||
| ProbeSet | varchar(40) | YES | |||||
| Name | varchar(40) | YES | MUL | ||||
| length | int(11) | NO |
EnsemblProbeLocation
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Chr | char(2) | NO | |||||
| Start | int(11) | NO | |||||
| Start_2016 | int(11) | YES | |||||
| End | int(11) | NO | |||||
| End_2016 | int(11) | YES | |||||
| Strand | int(11) | NO | |||||
| MisMataches | int(11) | YES | |||||
| ProbeId | int(11) | NO | MUL |
GORef
Comment:
Gene Ontology identifiers linked to gene symbols. Only properly implemented for mouse. Note that this table does not have a GORef.species field. GN1 code does return hits even for Drosophila but symbols have mouse format. Check how this happens. (RWW March 2016)
Important and should probably be updated periodically. Used for GO searches in GN1 and GN2. E.g. GO:0045202 searches for synapse-associated genes listed in the Gene Ontology using information in this table.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | int(11) | NO | PRI | auto_increment | |||
| goterm | varchar(255) | YES | |||||
| genes | text | YES |
Genbank
Comment:
DEPRECATED. Apparently only used by the "Probe Tools". This table contains a complete or truncated copy of GenBank sequence data associated with particular Affymetrix Probe sets. When a GenBank sequence entry was long, we took only the most terminal 1000 nt under the assumption that this was the 3' end of the sequence. This assumption will often be incorrect. This table is used primarily in association with Affymetrix Probe sets generated using GenBank sequence. The Probe Tools table in GN is able to BLAT the GenBank sequences provided in this table.
Created by Yanhua Qu, August 2005. Deprecated by RWW March 2016.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | varchar(20) | NO | PRI | conventional GenBank identifier of the sequence | |||
| Sequence | text | YES | up to 1000 nucleotides of sequence | ||||
| SpeciesId | smallint(5) unsigned | NO | 0 | species identifier used by GenBank and NCBI |
GeneCategory
Comment:
DEPRECATED. Used by GeneWiki notes to classify notes. This table has never been used.
If this table is deleted then please delete all checkboxes associated with GeneWiki data entry. RWW March 2016.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | |||
| Name | char(255) | NO | MUL |
GeneChip
Comment:
This table lists the array platforms that are used by the GeneNetwork. For example Affymetrix U74Av2, M430A, RAE230A. etc.
The name 'GeneChip' is much too specific. 'Platform' would be better term.
A new record can be inserted only if the relevant record in Species table is in place. ID1206
Please use the following conventions for naming array platform:
MG_U74AV2 is a good form but
Affy_U74Av2 would be better
Start with a four letter vendor code (Upper case lower case underscore)
"Affy_" for Affymetrix
"Illu_" for Illumina
"Agil_"
then use the name of the array given by the vendor
for example: U74AV2, MOE430A, MOE430B, MOE430V2, RAE230A, G4121A, MOUSE6.0, MOUSE6.1, MOUSE6.2
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | internal GN identifier of the array platform | ||
| GeneChipId | int(5) | YES | |||||
| GeneChipName | varchar(200) | YES | |||||
| Name | char(30) | NO | array platform long identifier or name | ||||
| GeoPlatform | char(15) | YES | |||||
| Title | varchar(100) | YES | |||||
| SpeciesId | int(5) | YES | 1 | Species:Id | species for which this array was designed to work best (U74Av2 for mouse, RAE230A for rat) | ||
| GO_tree_value | varchar(50) | YES |
GeneChipEnsemblXRef
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| GeneChipId | int(11) | NO | |||||
| EnsemblChipId | int(11) | NO |
GeneIDXRef
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| mouse | int(11) | NO | MUL | 0 | |||
| rat | int(11) | NO | MUL | 0 | |||
| human | int(11) | NO | MUL | 0 |
GeneInfo
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(10) | NO | PRI | auto_increment | |||
| GeneId | int(10) | YES | MUL | ||||
| TaxId | int(10) | YES | |||||
| SpeciesId | int(10) | YES | |||||
| Symbol | varchar(255) | YES | |||||
| Alias | longtext | YES | |||||
| Chr | char(3) | YES | |||||
| Mb | double | YES | |||||
| Probe_set_Blat_Mb_start | double | YES | |||||
| Probe_set_Blat_Mb_end | double | YES | |||||
| BlatSeq | text | YES | |||||
| Strand_Probe | char(1) | YES | |||||
| Strand_Gene | char(1) | YES | |||||
| OMIM | varchar(20) | YES | |||||
| HomoloGeneID | varchar(20) | YES |
GeneList
Comment:
Out of date in 2016. May be used by chromosome QTL maps and by SNP Tables. GN would need these data for multiple species. This is apparently meant as a generic table for any species. Should be updated periodically from BioMart or UCSC Genome Browser.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| SpeciesId | int(5) unsigned | NO | PRI | 1 | |||
| Id | int(10) unsigned | NO | PRI | ||||
| GeneSymbol | varchar(15) | YES | MUL | ||||
| GeneDescription | mediumtext | YES | |||||
| Chromosome | varchar(10) | YES | |||||
| TxStart | double | YES | We currently think that this should be the start of the 5' UTR but need to confirm | ||||
| TxStart_2016 | double | YES | |||||
| TxEnd | double | YES | We currently think that this should be the end of the 3' UTR but need to confirm | ||||
| TxEnd_2016 | double | YES | |||||
| Strand | char(1) | YES | |||||
| GeneID | varchar(10) | YES | This is the GeneID which used to be called the LocusLinkID | ||||
| NM_ID | varchar(15) | YES | This is the messenger RNA reference id number (nucleotide Message) | ||||
| kgID | varchar(10) | YES | |||||
| GenBankID | varchar(15) | YES | |||||
| UnigenID | varchar(15) | YES | Unigene IDs, often multiple | ||||
| ProteinID | varchar(15) | YES | |||||
| AlignID | varchar(10) | YES | |||||
| exonCount | int(7) | NO | 0 | ||||
| exonStarts | mediumtext | YES | This is a concatenated list of exon starts, separated by comma | ||||
| exonEnds | mediumtext | YES | This is a concatenated list of exon starts, separated by comma | ||||
| cdsStart | double | YES | This is the start of the coding sequence (cds = protein coding part of mRNA) | ||||
| cdsStart_2016 | double | YES | |||||
| cdsEnd | double | YES | This is the end of the coding sequence (cds = protein coding part of mRNA) | ||||
| cdsEnd_2016 | double | YES | |||||
| TxStart_mm8 | double | YES | |||||
| TxEnd_mm8 | double | YES | |||||
| Strand_mm8 | char(1) | YES | |||||
| exonCount_mm8 | int(7) | YES | |||||
| exonStarts_mm8 | mediumtext | YES | |||||
| exonEnds_mm8 | mediumtext | YES | |||||
| cdsStart_mm8 | double | YES | |||||
| cdsEnd_mm8 | double | YES | |||||
| Chromosome_mm8 | varchar(10) | YES | |||||
| Info_mm9 | mediumtext | YES | |||||
| RGD_ID | int(10) | YES |
GeneList081722
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| SpeciesId | int(5) unsigned | NO | MUL | 1 | |||
| Id | int(20) unsigned | NO | PRI | auto_increment | |||
| GeneSymbol | varchar(20) | YES | MUL | ||||
| GeneDescription | text | YES | |||||
| alias | longtext | YES | |||||
| Chr_mm11 | varchar(10) | YES | |||||
| TxStart_mm11 | double | YES | |||||
| TxEnd_mm11 | double | YES | |||||
| Strand_mm11 | char(1) | YES | |||||
| Chr_mm10 | varchar(10) | YES | |||||
| TxStart_mm10 | double | YES | |||||
| TxEnd_mm10 | double | YES | |||||
| Strand_mm10 | char(1) | YES | |||||
| Chr_mm9 | varchar(10) | YES | |||||
| TxStart_mm9 | double | YES | |||||
| TxEnd_mm9 | double | YES | |||||
| Strand_mm9 | char(1) | YES | |||||
| Chr_rn7 | varchar(10) | YES | |||||
| TxStart_rn7 | double | YES | |||||
| TxEnd_rn7 | double | YES | |||||
| Strand_rn7 | char(1) | YES | |||||
| Chr_rn6 | varchar(10) | YES | |||||
| TxStart_rn6 | double | YES | |||||
| TxEnd_rn6 | double | YES | |||||
| Strand_rn6 | char(1) | YES | |||||
| GeneID | varchar(15) | YES | |||||
| NM_ID | varchar(20) | YES | |||||
| kgID | varchar(10) | YES | |||||
| GenBankID | varchar(20) | YES | |||||
| UnigenID | varchar(20) | YES | |||||
| ProteinID | varchar(20) | YES | |||||
| AlignID | varchar(10) | YES | |||||
| exonCount | int(7) | NO | 0 | ||||
| exonStarts | text | YES | |||||
| exonEnds | text | YES | |||||
| cdsStart | double | YES | |||||
| cdsEnd | double | YES | |||||
| RGD_ID | int(20) | YES | |||||
| ENSEMBL_ID | varchar(50) | YES |
GeneList_rn3
Comment:
This table contains information on recognized genes in Rattus norvegicus (rn) from the rat build 3 (RGSC v3.4 of November 2004; see http://www.ncbi.nlm.nih.gov/genome/guide/rat/release_notes.html). Data are used by the Interval Analyst table in WebQTL. Data originally taken from UCSC ftp site July 2005. Annotation by Rob Williams and Senhua Yu, Aug. 2005. Created by Evan Williams, July 2005.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | int(10) unsigned | NO | PRI | auto_increment | |||
| ProbeSet | varchar(16) | YES | |||||
| geneSymbol | varchar(15) | YES | MUL | official gene symbol | |||
| geneID | varchar(10) | YES | Entrez gene ID | ||||
| kgID | varchar(10) | YES | |||||
| geneDescription | text | YES | official gene description | ||||
| genBankID | varchar(15) | YES | GenBank identifier | ||||
| unigenID | varchar(15) | YES | Unigene identifier (Build 144) | ||||
| score | int(4) | YES | |||||
| qStart | int(3) | YES | |||||
| qEnd | int(3) | YES | |||||
| qSize | int(3) | YES | |||||
| identity | varchar(7) | YES | |||||
| chromosome | varchar(8) | YES | MUL | ||||
| strand | char(1) | YES | |||||
| txStart | double | YES | |||||
| txEnd | double | YES | |||||
| txSize | double | YES | |||||
| span | int(7) | YES | |||||
| specificity | double | YES | Check status of this field. Really a probe set field, not a gene field. | ||||
| sequence | text | YES | Check status of this field. Really a probe set field, not a gene field. | ||||
| flag | int(1) | YES | Check status of this field. Really a probe set field, not a gene field. |
GeneList_rn33
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | int(10) unsigned | NO | PRI | auto_increment | |||
| geneSymbol | varchar(15) | YES | MUL | ||||
| txStart | double | YES | |||||
| txEnd | double | YES | |||||
| exonCount | int(7) | YES | |||||
| NM_ID | varchar(15) | YES | |||||
| chromosome | varchar(8) | YES | MUL | ||||
| strand | char(1) | YES | |||||
| cdsStart | double | YES | |||||
| cdsEnd | double | YES | |||||
| exonStarts | text | YES | |||||
| exonEnds | text | YES | |||||
| kgID | varchar(10) | YES |
GeneMap_cuiyan
Comment:
Deprecated. This is a table used to link from GN1 single chromosome maps to Yan Cui's polyMiRTS database of microRNA binding sites linked to SNPs.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | bigint(20) | NO | PRI | auto_increment | |||
| TranscriptID | varchar(255) | YES | |||||
| GeneID | varchar(255) | YES | |||||
| Symbol | varchar(255) | YES |
GeneRIF
Comment:
This is to be more than just GeneRIF but also includes GeneWIKI fields used to allow users to enter new GeneWiki data sets. Should be renamed GeneWiki_Entry_Data
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(10) unsigned | NO | PRI | 0 | |||
| versionId | smallint(5) unsigned | NO | PRI | 0 | |||
| symbol | varchar(30) | NO | MUL | Official gene symbol taken from NCBI | |||
| PubMed_ID | varchar(255) | YES | |||||
| SpeciesId | smallint(5) unsigned | NO | 1 | ||||
| comment | mediumtext | YES | |||||
| varchar(50) | YES | ||||||
| createtime | datetime | NO | MUL | 0000-00-00 00:00:00 | |||
| user_ip | varchar(20) | YES | |||||
| weburl | varchar(255) | YES | |||||
| initial | varchar(10) | YES | |||||
| display | tinyint(4) | YES | MUL | 1 | |||
| reason | varchar(100) | NO |
GeneRIFXRef
Comment:
Gene RIF link to corresponding NCBI PubMed Reference ID. (RWW March 2016). Odd that there are three primary keys. (RWW March 2016)
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| GeneRIFId | int(10) unsigned | NO | PRI | 0 | |||
| versionId | smallint(5) unsigned | NO | PRI | 0 | |||
| GeneCategoryId | smallint(5) unsigned | NO | PRI | 0 |
GeneRIF_BASIC
Comment:
Gene Reference into Function data table from NCBI. Data are updated each night from NCBI and used to perform RIF queries in GN1 and GN2. (RWW March 2016). Probably should be called "GeneRIF_Data_NCBI"
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| SpeciesId | smallint(5) unsigned | NO | PRI | 1 | |||
| TaxID | int(10) | YES | |||||
| GeneId | int(10) unsigned | NO | PRI | 0 | |||
| symbol | varchar(255) | NO | MUL | ||||
| PubMed_ID | int(10) unsigned | NO | PRI | 0 | |||
| createtime | datetime | NO | PRI | 0000-00-00 00:00:00 | |||
| comment | mediumtext | YES | MUL | ||||
| VersionId | smallint(5) unsigned | NO | PRI |
Geno
Comment:
Genotype marker information, not the actual genotypes. Should probably be renamed "Marker_Information" or "Genotype_Marker_Info". If genotype data is held in MySQL, then this table is used for updating genotypes and for the production of a new ".GENO" file after an update. Currently, the update feature i used almost exclusively for BXD mouse cohort. Contains 400,000 rows each with sequence data around markers (usually SNPs, but some microsatellites and other weird variants). (RWW March 2016)
This table contains descriptions of markers, the same ones that are used in the corresponding .geno file. This table is exactly the same as Geno_0609, so one of them might be redundant and also has one-to-one relationship with Geno2 table. For some information there is more than one entry (marker name, position) which may lead to inconsistent state. The marker fields look like references to single nucleotide poymorphisms within the marker, but this hasn't been confirmed.
For a few groups, this table can be updated by authorized users using an interface at www.genenetwork.org/manager.html (Update Genotype functions) (comment updated March 14, 2016 by RWW)
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(10) unsigned | NO | PRI | auto_increment | Primary key, used in Geno2, GenoXRef | ||
| SpeciesId | smallint(5) unsigned | NO | MUL | 1 | |||
| Name | varchar(40) | NO | Marker name, or other ID used in .geno file | ||||
| Marker_Name | varchar(40) | YES | |||||
| Chr | char(3) | YES | Chr_Length.Name | ||||
| Mb | double | YES | This may be the genome-wide megabase values that is cumulative. Chr 2 starts at about 200 Mb. (Double check) | ||||
| Mb_2016 | double | YES | |||||
| Sequence | longtext | YES | The sequence of the marker, if known. Usually 100 nt on each side of the SNP with the SNP is square brackets for BLAT analysis. gctcctaattgctgagatttctctccagctc TGCCTCCCTTTCACACTCTCCTGCCCGTCCC AATCAGAACATTAGAGCTGATAAGATTTACT TATGGAC[CT]GATCTAAAATAGAAGTCCTT TGGAGAACTTTGAGAGCTTTTCCAAGAAGTA AAGTCGGTTAGTTGCTTTTCCAAAGAAATAA AGTTAGTGATTCTCCACA |
||||
| Source | varchar(40) | YES | The provider of the information, could be institute. | ||||
| chr_num | smallint(5) unsigned | YES | Chr_Length.OrderId | This is a number used to order chromosomes, thus Chr X in mouse = Chr 20, and Chr Y = 21 | |||
| Source2 | varchar(40) | YES | The provider of the information, could be institute, often the same as Source. | ||||
| Comments | varchar(255) | YES | Comment | ||||
| used_by_geno_file | varchar(40) | YES | This is a flag that determines if a marker is used for mapping. Can be set by authorized users using the "Update Genotype" function. May be redundant with field in GenoXRef. | ||||
| Mb_mm8 | double | YES | Megabase position (not bp). Should be deleted or updated to mm10 (March2016) | ||||
| Chr_mm8 | char(3) | YES | Chromosome name. Should be deleted or updated to mm10 (March2016) |
GenoCode
Comment:
Only has one row as of March 2016 and used exclusively for BXD or B6xD2 crosses.
May be used for Haplotype Analyst display function in QTL maps. May also be used to determine polarity of effect size (B allele defined as -1 and D allele defined as 1).
Inbred Set 1, AlleleType values mat, pat, het, unk, and AlleleSymbol B, D, H, U, and DatabaseValue -1, 1, 0 or NULL
"InbredSetId" should be renamed "GroupID" or "CohortID"
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| InbredSetId | smallint(5) unsigned | NO | PRI | 1 | |||
| AlleleType | char(3) | NO | PRI | ||||
| AlleleSymbol | char(2) | NO | PRI | ||||
| DatabaseValue | smallint(5) | YES |
GenoData
Comment:
This is the table that actually contains genotypes for individuals. Could be renamed "Genotype_Data". The GenoData.value will need to be updated to allow a wider range of values and probabilities to accommodate complex crosses and cohorts. Right now the GenoData.value is labeled as a "float" but most of the code in GN expects to see values of -1, 0, or 1.
As of March 2016 (140 million rows where each row is genotype from individual X at marker Y)
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(10) unsigned | NO | MUL | 0 | Primary key identifier | ||
| StrainId | int(5) | YES | This field should be renamed SampleID. | ||||
| value | float | NO | The actual genotype of the case. Usually -1, 0, 1. U is not allowed yet. No blank allowed. |
GenoFile
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | int(11) | NO | PRI | auto_increment | |||
| server | varchar(100) | NO | |||||
| InbredSetID | int(11) | NO | |||||
| location | varchar(255) | NO | |||||
| title | varchar(255) | NO | |||||
| sort | int(3) | YES |
GenoFreeze
Comment:
Population or cohort description. Links the population or cohort data described here with the genotype information. The entry in this table must be present to enter the genotype data in the GenXRef and Data tables.
As of March 2016 has about 26 rows for mouse, rat, Drosopholia, potatoe, human, etc.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | Primary key referenced in GenoXRef.GenoFreezeId. | ||
| Name | varchar(100) | NO | Genotype file for the cohort name. | ||||
| FullName | varchar(100) | NO | Extended genotype file name for the cohort. | ||||
| ShortName | varchar(100) | NO | Shortened genotype name. | ||||
| CreateTime | date | NO | 2001-01-01 | now() | |||
| public | tinyint(4) | NO | 0 | 1 = beta data, 2 = available in GeneNetwork. | |||
| InbredSetId | smallint(5) unsigned | YES | 1 | InbredSet.Id | links to the mapping population. | ||
| confidentiality | tinyint(3) unsigned | YES | 0 | 0 = not confidential, 1 = confidential. | |||
| AuthorisedUsers | varchar(100) | YES |
GenoSE
Comment:
DELETE THIS TABLE. This is to be a stupid table that can be deleted (Rob W, March 2016). Likely to have been added as a parallel table similar to those used from phenotypes and quantitative traits.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| DataId | int(10) unsigned | NO | PRI | 0 | |||
| StrainId | smallint(5) unsigned | NO | PRI | 0 | |||
| error | float | NO |
GenoXRef
Comment:
The table is used to establish links to other tables that contain genotype data. contains the information on which markers should be used for QTL mapping
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| GenoFreezeId | smallint(5) unsigned | NO | PRI | 0 | The GenoFreezeID is the number that references a single coherent genotype file. For example the first BXDgeno file is 0001. | ||
| GenoId | int(10) unsigned | NO | PRI | 0 | GenoID is an identifier for a specific marker (SNP or other) | ||
| DataId | int(10) unsigned | NO | UNI | 0 | DataID is an identifier for a specific vector of genotypes | ||
| cM | double | YES | 0 | cM is the centiMorgan location of the marker | |||
| Used_for_mapping | char(1) | YES | N | Flag used to decide if a marker is used for mapping or not |
H2
Comment:
Deprecated or delete this table (RWW March 2016). Compare to "Probe h2" used in Probe Table. Plain "H2" table has 60,000. This could be at the probe set level whereas "Probe h2" is for the individual probes on the probe set. (Danny Arends = DA March 2016)
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| DataId | int(10) unsigned | NO | PRI | 0 | |||
| ICH2 | double | NO | 0 | ||||
| H2SE | double | NO | 0 | heritability standard error ?? | |||
| HPH2 | double | NO | 0 |
Homologene
Comment:
Coupling genes to other genes using homology between them. (DA March 2016)
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| HomologeneId | int(11) | YES | |||||
| GeneId | int(11) | YES | MUL | ||||
| TaxonomyId | int(11) | YES |
InbredSet
Comment:
Important table that is used to select appropriate analytic and mapping methods. We should change the name of this table to "Population_Description" or "Sample_Description" (RWW March 2016)
"orderid" is used to set the order of in the pull-down menu.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | |||
| InbredSetId | int(5) | YES | |||||
| InbredSetName | varchar(100) | YES | |||||
| Name | char(30) | NO | |||||
| SpeciesId | smallint(5) unsigned | YES | 1 | ||||
| FullName | varchar(100) | YES | |||||
| public | tinyint(3) unsigned | YES | 2 | ||||
| MappingMethodId | char(50) | YES | 1 | prefered mapping method to use ?? | |||
| GeneticType | varchar(255) | YES | e.g. intercross | ||||
| Family | varchar(100) | YES | |||||
| FamilyOrder | int(5) | YES | |||||
| MenuOrderId | double | NO | |||||
| InbredSetCode | varchar(5) | YES | |||||
| Description | longtext | YES |
IndelAll
Comment:
Information about indels (comaprable to the SNP data) used by the Mouse SNP browser GN1 only at this time. Only B6 versus D2 mouse indels have been entered so far. Has 140,000 rows but should have at least twice as many. Probably entered at an early stage of sequence analysis (circa 2010) (DA March 2016)
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(10) unsigned | NO | PRI | auto_increment | |||
| SpeciesId | smallint(5) unsigned | YES | MUL | 1 | |||
| SourceId | smallint(5) unsigned | YES | |||||
| Name | char(30) | YES | MUL | ||||
| Chromosome | char(2) | YES | |||||
| Mb_start | double | YES | |||||
| Mb_start_2016 | double | YES | |||||
| Strand | char(1) | YES | |||||
| Type | char(15) | YES | |||||
| Mb_end | double | YES | |||||
| Mb_end_2016 | double | YES | |||||
| Size | double | YES | |||||
| InDelSequence | char(30) | YES |
IndelXRef
Comment:
Just for C57BL/6J and DBA/2J indels with 140,000 rows
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| IndelId | int(10) unsigned | NO | PRI | 0 | |||
| StrainId1 | smallint(5) unsigned | NO | PRI | 0 | |||
| StrainId2 | smallint(5) unsigned | YES |
InfoFiles
Comment:
INFO file metadata. INFO files are currently limited to molecular data sets (mRNA, protein, metabolomes). Majority of mRNA transcriptome data sets. This table set up by Arthur 2014-2015. Compare to "Datasets" which appears to be a subset of this table.
"InfoFiles" has 700 rows whereas "Datasets" has only 230 rows (RWW March 2016)
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| DatasetId | int(5) | YES | |||||
| SpeciesId | int(5) | YES | |||||
| TissueId | int(5) | YES | |||||
| InbredSetId | int(5) | YES | |||||
| GeneChipId | int(5) | YES | |||||
| AvgMethodId | int(5) | YES | |||||
| InfoFileTitle | longtext | YES | |||||
| Specifics | longtext | YES | |||||
| Status | varchar(255) | YES | |||||
| Title | varchar(255) | YES | |||||
| Organism | varchar(255) | YES | |||||
| Experiment_Type | longtext | YES | |||||
| Summary | longtext | YES | |||||
| Overall_Design | longtext | YES | |||||
| Contributor | longtext | YES | |||||
| Citation | longtext | YES | |||||
| Submission_Date | varchar(255) | YES | |||||
| Contact_Name | varchar(255) | YES | |||||
| Emails | varchar(255) | YES | |||||
| Phone | varchar(255) | YES | |||||
| URL | varchar(255) | YES | |||||
| Organization_Name | varchar(255) | YES | |||||
| Department | varchar(255) | YES | |||||
| Laboratory | varchar(255) | YES | |||||
| Street | varchar(255) | YES | |||||
| City | varchar(255) | YES | |||||
| State | varchar(255) | YES | |||||
| ZIP | varchar(255) | YES | |||||
| Country | varchar(255) | YES | |||||
| Platforms | varchar(255) | YES | |||||
| Samples | longtext | YES | |||||
| Species | varchar(255) | YES | |||||
| Normalization | varchar(255) | YES | |||||
| InbredSet | varchar(255) | YES | |||||
| InfoPageName | varchar(255) | NO | UNI | ||||
| DB_Name | varchar(255) | YES | |||||
| Organism_Id | varchar(60) | YES | |||||
| InfoPageTitle | varchar(255) | YES | |||||
| GN_AccesionId | int(4) | YES | UNI | ||||
| Tissue | varchar(60) | YES | |||||
| AuthorizedUsers | varchar(100) | YES | |||||
| About_Cases | longtext | YES | |||||
| About_Tissue | longtext | YES | |||||
| About_Download | longtext | YES | |||||
| About_Array_Platform | longtext | YES | |||||
| About_Data_Values_Processing | longtext | YES | |||||
| Data_Source_Acknowledge | longtext | YES | |||||
| Progreso | varchar(20) | YES | |||||
| QualityControlStatus | longtext | YES | |||||
| InfoFileId | int(6) | NO | PRI | auto_increment |
InfoFilesUser_md5
Comment:
Password information GN1 (unsecure no salt) use SALT !
Only two users as of March 2016, Rob and Arthur.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Username | varchar(16) | YES | |||||
| Password | varchar(32) | YES |
Investigators
Comment:
What is this used for? This is part of Arthur Centeno's database for INFO files.
As of March 2016 has about 86.54 rows.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| FirstName | varchar(20) | YES | |||||
| LastName | varchar(20) | YES | |||||
| Address | varchar(200) | YES | |||||
| City | varchar(20) | YES | |||||
| State | varchar(20) | YES | |||||
| ZipCode | varchar(20) | YES | |||||
| Phone | varchar(200) | YES | |||||
| varchar(200) | YES | ||||||
| Country | varchar(35) | YES | |||||
| Url | text | YES | |||||
| UserName | varchar(30) | YES | |||||
| UserPass | varchar(255) | YES | |||||
| UserDate | datetime | YES | |||||
| UserLevel | int(8) | YES | |||||
| active | enum('0','1') | YES | |||||
| token | varchar(255) | YES | |||||
| OrganizationId | int(5) | YES | |||||
| InvestigatorId | int(5) | NO | PRI | auto_increment |
LCorrRamin3
Comment:
Should be updated in 2016. Literature correlations by Prof Ramin Homayouni (v3) in GN1 and GN2. These are mouse GeneIDs (table starts with GeneId1 = 381629 = the gene with symbol Atraid in mouse. This genes maps to HomoloGene 15412 and to human ATRAID (human GeneId 51374). This table should ideally work for mouse, human, and rat since most genes will have 1-to-1 homologs with matched symbols.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| GeneId1 | int(12) unsigned | YES | MUL | Entrez gene ID values (mouse) | |||
| GeneId2 | int(12) unsigned | YES | MUL | Entrez gene ID values (mouse) | |||
| value | double | YES | Latent sematic index scorel, value between 0 and 1 |
MachineAccessLog
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | int(10) unsigned | NO | PRI | auto_increment | |||
| accesstime | datetime | NO | 0000-00-00 00:00:00 | ||||
| ip_address | char(20) | NO | 0.0.0.0 | ||||
| db_id | tinyint(3) unsigned | NO | 0 | ||||
| data_id | int(10) unsigned | YES | |||||
| action | char(10) | YES |
MappingMethod
Comment:
Needs to be updated, but this is used in GN1 to select mapping methods for different cohorts/populations. PLINK is used for map human cohorts in GN1. Happy is not implemented as of March 2016 in either GN1 or GN2. R/qtl implemented by DA in GN2 in 2015. FastMap probably equal pyLMM and should be renamed. QTL Reaper = Haley Knott regression mapping and probably should be renamed HKMap.
QTL Reaper, R/qtl, Happy, PLINK, FastMap
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | |||
| Name | varchar(100) | NO |
NStrain
Comment:
Merge this table to "PublishSE" and "PublishData". Values are used to track n of cases or n or strains for "published" phenotype values. Move these data to PublishSE and PublishData, phenotype SE, and N strain are three columns shows to users of Published Phenotypes. Unknown function at this time, seems like this contains information which is derived, so looks like it might be unneeded (DA March 2016).
Contains 160,000 rows, March 2016.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| DataId | int(10) unsigned | YES | MUL | ||||
| StrainId | int(20) | YES | |||||
| count | varchar(5) | YES |
News
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | int(11) | NO | PRI | auto_increment | |||
| date | date | YES | |||||
| details | text | YES |
Organizations
Comment:
Table generated by Arthur Centeno for INFO files and metadata.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| OrganizationId | int(5) | NO | PRI | auto_increment | |||
| OrganizationName | varchar(200) | NO | UNI |
Phenotype
Comment:
This table contains names, full descriptions, and short symbols for traits and phenotype used primarily in the Published Phenotypes databases.
Contains 10k rows, March 2016, of which 5000 are for the BXDs).
Created by Jintao Wang, March 2003.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | |||
| Pre_publication_description | mediumtext | YES | MUL | ||||
| Post_publication_description | mediumtext | YES | MUL | ||||
| Original_description | mediumtext | YES | |||||
| Units | varchar(100) | NO | Unknown | units of measurement of the phenotype | |||
| Pre_publication_abbreviation | varchar(60) | YES | MUL | ||||
| Post_publication_abbreviation | varchar(60) | YES | MUL | ||||
| Lab_code | varchar(255) | YES | |||||
| Submitter | varchar(255) | YES | |||||
| Owner | varchar(255) | YES | |||||
| Authorized_Users | varchar(255) | YES |
Probe
Comment:
DEPRECATED. Used only for a few array platforms in GN1. Not used for GN2. This table contains data on the characteristics of individual Affymetrix probes (not probe sets). Data are used to populate the Probe Tables which display sequences of the perfect match and mismatch probes. This table could also contain data on the Agilent 60-mer probes.
Created by Yanhua Qu and Jintao Wang, 2003.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(10) unsigned | NO | PRI | auto_increment | internal identifier | ||
| ProbeSetId | int(10) unsigned | NO | MUL | 0 | Affymetrix probe set identifier to which the probe belongs using the conventional CDF probe-probeset mapping | ||
| Name | char(20) | YES | six to eight character name (depending on array) XXX coordinate then YYY coordinate with 0 used a buffer | ||||
| Sequence | char(30) | YES | 25 nucleotide sequence | ||||
| ExonNo | char(7) | YES | exon to which the probe sequence corresponds. When a probe straddles two exons we use the format 10*11 | ||||
| SerialOrder | double | YES | probe order from the most 3' probe to the most 5' probe | ||||
| Tm | double | YES | theoretical melting temperature of a DNA-DNA hybrid. The actual probes are cRNA | ||||
| E_GSB | double | YES | the gene-specific binding energy computed using Li Zhang's PDNN method. Data provided by Li Zhang | ||||
| E_NSB | double | YES | the non-specific binding energy computed using Li Zhang's PDNN method. Data provided by Li Zhang |
ProbeData
Comment:
Table with fine-grained probe level Affymetrix data only. Contains 1 billion rows March 2016. This table may be deletable since it is only used by the Probe Table display in GN1. Not used in GN2 (double-check).
In comparison the "ProbeSetData" table contains more molecular assay data, including probe set data, RNA-seq data, proteomic data, and metabolomic data. 2.5 billion rows March 2016. In comparison, ProbeData contains data only for Affymetrix probe level data (e.g. Exon array probes and M430 probes).
"ProbeData.StrainId" should be "CaseId" or "SampleId".
"ProbeData" should probably be "AssayData" or something more neutral.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(10) unsigned | NO | PRI | 0 | |||
| StrainId | smallint(5) unsigned | NO | PRI | 0 | |||
| value | float | NO |
ProbeFreeze
Comment:
About the Name: ProbeFreeze is a stupid (historic) name for this table. The table should be renamed to more general and sensible such as "Data_Set_Group_Info" table and ProbeSetFreeze should be changed to something like "Data_Set_Info" table. At present, every ProbeSetFreeze record needs a parent ProbeFreeze record, even when the relation is 1-to-1.
About This Table: The ProbeFreeze table provides information about the overall set of microarray hybridization experiments - a meaningful name that identifies the experiment, the link to the microarray chip name, the link to tissue, organ or other generic biological material name, the link to the mapping population, inbred strain set name or similar used in the experiment.
A ProbeFreeze may have a subset of ProbeSetFreezes (one ProbeFreeze to many ProbeSetFreezes) to which it belongs as children data sets (for example, male data only, female data only, RMA data or MAS5 data. The name provides a short description of the experiment. New records in the table should be inserted only after the relevant records in the GeneChip, Tissue and InbredSet are in place. 34 records on Dec14,2006. ID1206
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | Primary key | Incremented integer, uniquely idenifies the record. ID1206 | |
| ProbeFreezeId | int(5) | YES | |||||
| ChipId | smallint(5) unsigned | NO | 0 | GeneChip:Id | Links to the information about the microarray chip used. ID1206 | ||
| TissueId | smallint(5) unsigned | NO | 0 | Tissue:Id | Links to the information about the biological material analysed . ID1206 | ||
| Name | varchar(100) | NO | UNI | Abbreviated description that identifies the microarray experiment. The existing records contain institute id, short biological material description, the microarray chip name and date in brackets, but the field can contain any meaningful description of the microarray experiment. ID1206 | |||
| FullName | varchar(100) | NO | Empty field. ID1206 | ||||
| ShortName | varchar(100) | NO | Empty field. ID1206 | ||||
| CreateTime | date | NO | 0000-00-00 | now() | |||
| InbredSetId | smallint(5) unsigned | YES | 1 | InbredSet:Id | Links to the information about the cross, mapping population, inbred strain set or similar used in the experiment. ID1206 |
ProbeH2
Comment:
DEPRECATED. Will not be used in GN2. Please compare to H2. Used only for some the heritability of probes shown in the Probe table.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| ProbeFreezeId | smallint(5) unsigned | NO | PRI | 0 | |||
| ProbeId | int(10) unsigned | NO | PRI | 0 | |||
| h2 | double | YES | |||||
| weight | double | YES |
ProbeSE
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| DataId | int(10) unsigned | NO | PRI | 0 | |||
| StrainId | smallint(5) unsigned | NO | PRI | 0 | |||
| error | float | NO |
ProbeSet
Comment:
PLEASE CHANGE TABLE NAME and rework fields carefully. This is a terrible table but it works well (RWW March 2016). It is used in combination with the crucial TRAIT DATA and ANALYSIS pages in GN1 and GN2. It is also used by annotators using the UPDATE INFO AND DATA web form to correct and update annotation. It is used by Arthur to enter new annotation files and metadata for arrays, genes, proteins, metabolites. The main problem with this table is that it is doing too much work.
Initially (2003) this table contained only Affymetrix ProbeSet data for mouse (U74aV2 initially). Many other array platforms for different species were added. At least four other major categories of molecular assays have been added since about 2010.
1. RNA-seq annotation and sequence data for transcripts using ENSEMBL identifiers or NCBI NM_XXXXX and NR_XXXXX type identifiers
2. Protein and peptide annotation and sequence data (see BXD Liver Proteome data, SRM and SWATH type data) with identifiers such as "abcb10_q9ji39_t311" for SRM data and "LLGNMIVIVLGHHLGKDFTPAAQAA" for SWATH data where the latter is just the peptide fragment that has been quantified. Data first entered in 2015 for work by Rudi Aebersold and colleagues.
3. Metabolite annotation and metadata (see BXD Liver Metabolome data) with identifiers that are usually Mass charge ratios such as "149.0970810_MZ"
4. Epigenomic and methylome data (e.g. Human CANDLE Methylation data with identifiers such as "cg24523000")
It would make good sense to break this table into four or more types of molecular assay metadata or annotation tables) (AssayRNA_Anno, AssayProtein_Anno, AssayMetabolite_Anno, AssayEpigenome_Anno, AssayMetagenome_Anno), since these assays will have many differences in annotation content compared to RNAs.
Some complex logic is used to update contents of this table when annotators modify and correct the information (for example, updating gene symbols). These features requested by Rob so that annotating one gene symbol in one species would annotate all gene symbols in the same species based on common NCBI GeneID number. For example, changing the gene alias for one ProbeSet.Id will changing the list of aliases in all instances with the same gene symbol.
If the ProbeSet.BlatSeq (or is this ProbSetTargetSeq) is identical between different ProbeSet.Ids then annotation is forced to be the same even if the symbol or geneID is different. This "feature" was implemented when we found many probe sets with identical sequence but different annotations and identifiers.
Annotation by Rob Williams, Aug 19, 2005. Created by Jintao Wang, 2003. This annotation updated March 22, 2016 by Rob.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(10) unsigned | NO | PRI | auto_increment | internal identifer used by GeneNetwork | ||
| ChipId | smallint(5) unsigned | NO | MUL | 0 | identifier of the array type | ||
| Name | varchar(100) | YES | MUL | Affymetrix probe set identifier or Agilent probe identifier | |||
| TargetId | varchar(150) | YES | MUL | ||||
| Symbol | varchar(100) | YES | MUL | gene symbol assigned to the probe set or probe (editable using Update page interface) | |||
| description | longtext | YES | gene description assigned to the probe set or probe (editable using Update page interface) | ||||
| Chr | char(3) | YES | MUL | chromosome assigned to the probe set or probe (editable using Update page interface) | |||
| Mb | double | YES | |||||
| Chr_2016 | char(3) | YES | |||||
| Mb_2016 | double | YES | |||||
| alias | longtext | YES | MUL | gene aliases and old symbols associated with the gene assigned to the probe set or probe (editable using Update page interface) | |||
| GeneId | varchar(20) | YES | MUL | Entrez gene ID assigned to the probe set or probe (editable using Update page interface) | |||
| GenbankId | varchar(1000) | YES | MUL | GenBank ID assigned to the probe set or probe as given to us by Affymetrix or Agilent (not editable from Update page) | |||
| SNP | int(2) | YES | unknown use | ||||
| BlatSeq | mediumtext | YES | probe sequence or concatenated probe set sequence ( trimmed of overlap) used for BLAT alignment to genome (viewable but not editable from Update page) | ||||
| TargetSeq | mediumtext | YES | target sequence as given to us by Affymetrix (viewable but not editable from Update page) | ||||
| UniGeneId | varchar(100) | YES | chromosome assigned to the probe set or probe (viewable but not editable from Update page) | ||||
| Strand_Probe | char(1) | YES | unknown use (redundant with Probe_set_strand ?) (editable using Update page interface) | ||||
| Strand_Gene | char(1) | YES | the DNA strand (+ or -) of the gene assigned to the probe set or probe (editable using Update page interface) | ||||
| OMIM | varchar(20) | YES | OMIM identifier assigned to the probe set or probe (editable using Update page interface) | ||||
| comments | mediumtext | YES | record of modification time and person making modifications. Used to prevent overwriting of modified records. | ||||
| Probe_set_target_region | varchar(255) | YES | DO NOT USE. Unknown use. May want to delete this field after review of possible use. | ||||
| Probe_set_specificity | double | YES | the BLAT score of the correct probe set target mRNA divided by the best or next best BLAT score | ||||
| Probe_set_BLAT_score | double | YES | the BLAT score generated by the concatenated probe set (or probe) sequence for the correct target mRNA. This will usually be the highest BLAT score, but in some cases a non-trasncribed genomic sequence may match better than the actual transcribed mRNA target sequence. | ||||
| Probe_set_Blat_Mb_start | double | YES | the proximal (low) megabase position matched by the probe set sequence (3' or 5' end) | ||||
| Probe_set_Blat_Mb_end | double | YES | the distal (high) megabase position matched by the probe set sequence (5' or 3' end) | ||||
| Probe_set_Blat_Mb_start_2016 | double | YES | |||||
| Probe_set_Blat_Mb_end_2016 | double | YES | |||||
| Probe_set_strand | varchar(255) | YES | the DNA strand (+ or -) that is identical to the probe set nucleotide sequence. By convention, correctly directed probe sets have the same direction as the gene. | ||||
| Probe_set_Note_by_RW | varchar(255) | YES | notes of the probe set by Robert Williams | ||||
| flag | char(1) | YES | a status flag on the probe set: 0=mismatch between blat results and affy symbols (Problem!!!!); 1=match between blat results and affy symbols (Excellent); 2=symbols from TIGR or replaced by Blat symbols (The original affy symbols have "///" or "_predicted") (ok); 3: symbols from BLAT (ok); 4. symbols from Affy (not bad) or no symbol (sad); 5. symbols from target sequence blating (??); 6. symbols from genebank sequence blating (???); 7=symbols from blating to mouse genome(????) | ||||
| Symbol_H | varchar(100) | YES | official human gene symbol from UCSC ftp site (hg17) | ||||
| description_H | varchar(255) | YES | official human gene description from NCBI ftp site (Build 35) | ||||
| chromosome_H | char(3) | YES | official human gene description from UCSC ftp site (Build 35) | ||||
| MB_H | double | YES | Converted from ProbeSet.Mb_mm6 by Batch Coordinate Conversion | ||||
| alias_H | varchar(255) | YES | official human gene description from NCBI ftp site (Build 35) | ||||
| GeneId_H | varchar(20) | YES | official human gene description from NCBI ftp site (Build 35) | ||||
| chr_num | smallint(5) unsigned | YES | 30 | the numerical value of chromosomes, for example, X is 20 or 21 depending on species | |||
| name_num | int(10) unsigned | YES | 4294967290 | the numerical value of Affymetrix probe set identifier or Agilent probe identifier | |||
| Probe_Target_Description | varchar(225) | YES | description of the region of the gene and transcript targetted by the probe set or probe (this text is displayed after the semicolon in Search Results; this is a searchable field) | ||||
| RefSeq_TranscriptId | varchar(255) | YES | MUL | the reference sequence of the mRNA associated with the probe set. These are always receded with "NM_". This field was added to allow easier linkage from the UCSC Genome Browser to GN. | |||
| ENSEMBLGeneId | varchar(50) | YES | |||||
| Chr_mm8 | char(3) | YES | |||||
| Mb_mm8 | double | YES | |||||
| Probe_set_Blat_Mb_start_mm8 | double | YES | |||||
| Probe_set_Blat_Mb_end_mm8 | double | YES | |||||
| HomoloGeneID | varchar(20) | YES | |||||
| Biotype_ENS | varchar(255) | YES | |||||
| ProteinID | varchar(50) | YES | |||||
| ProteinName | varchar(50) | YES | |||||
| UniProtID | varchar(20) | YES | |||||
| Flybase_Id | varchar(25) | YES | |||||
| RGD_ID | int(10) | YES | |||||
| HGNC_ID | int(10) | YES | |||||
| HMDB_ID | varchar(255) | YES | |||||
| Confidence | int(5) | YES | |||||
| ChEBI_ID | int(10) | YES | |||||
| ChEMBL_ID | varchar(100) | YES | |||||
| CAS_number | varchar(100) | YES | |||||
| PubChem_ID | int(10) | YES | |||||
| ChemSpider_ID | int(10) | YES | |||||
| UNII_ID | varchar(100) | YES | |||||
| EC_number | varchar(100) | YES | |||||
| KEGG_ID | varchar(100) | YES | |||||
| Molecular_Weight | double | YES | |||||
| Nugowiki_ID | int(10) | YES | |||||
| Type | varchar(255) | YES | |||||
| Tissue | varchar(255) | YES | |||||
| PrimaryName | varchar(255) | YES | |||||
| SecondaryNames | longtext | YES | |||||
| PeptideSequence | varchar(20) | YES | |||||
| id64 | varchar(100) | YES |
ProbeSetData
Comment:
Almost all important molecular assay data is in this table including probe set data, RNA-seq data, proteomic data, and metabolomic data. 2.5 billion rows March 2016. In comparison, ProbeData contains data only for Affymetrix probe level data (e.g. Exon array probes and M430 probes).
"StrainId" should be "CaseId" or "SampleId".
"ProbeSetData" should probably be "AssayData" or something more neutral.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(10) unsigned | NO | PRI | 0 | |||
| StrainId | int(20) | NO | PRI | ||||
| value | float | NO |
ProbeSetFreeze
Comment:
RENAME: AssayDataSet or something more neutral. Delete the word "Freeze" from this table.
ProbeSetFreeze contains the information of the data analysis method used in the processing the microarray experiment data described in the ProbeFreeze table and the confidentiality of the resulting data. New records should be inserted only if the relevant ProbeFreeze and AvgMethod records are in place. The use of the four different name fields effectively containing 4 versions of the same information needs to be clarified. 120 records on Dec 2006. About 700 records March 2016.
The name of a data set in GN is "ProbeSetFreeze.FullName" and is used in several output tables and graphs, for example ClusterMap in this format -- ProbesetID::FullName
Comment by PP and RW March 2016: This key table needs to be evaluated and renamed. Was initially designed to hold large microarray data, but now must accommodate any large "omics" data, but not genotypes and not classic phenotypes. Some trait data is ambiguous such as metagenomics. Metagenomics probably should be included here rather than in Phenotypes.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | Primary Key | Incremented integer, uniquely identifies the record. ID1206 | |
| ProbeFreezeId | smallint(5) unsigned | NO | 0 | ProbeFreeze:Id | Links to the microarray experiment description in ProbeFreeze table. ID1206 | ||
| AvgID | smallint(5) unsigned | NO | 0 | AvgMethod:Id | Links to the method used in the processing of the microarray experiment data (like RMA, MAS etc.). ID1206 | ||
| Name | varchar(40) | YES | UNI | Very short abbreviation of the microarray experiment description, the use needs to be clarified. Contains tissue abbreviaton_chip abbreviation_date_processing method abbreviation. ID1206 | |||
| Name2 | varchar(100) | NO | MUL | The same as in Name, only a bit longer - tissue_chip_method_date. The use needs to be clarified. ID1206 | |||
| FullName | varchar(100) | NO | UNI | Similar to ProbeFreeze name (institute tissue chip date)+ the data analysis method used. ID1206 | |||
| ShortName | varchar(100) | NO | Similar to FullName with random items abbreviated. ID1206 | ||||
| CreateTime | date | NO | 0000-00-00 | now() | |||
| OrderList | int(5) | YES | |||||
| public | tinyint(4) | NO | 0 | 1 = beta data, 2 = available in GeneNetwork. ID1206. beta means the dataset will not appear in the search page if the user does not login | |||
| confidentiality | tinyint(4) | NO | 0 | 0 = not confidential, 1 = confidential. ID1206. confidential means the dataset will appear in the search page, but will be serached only after the user login | |||
| AuthorisedUsers | varchar(300) | NO | |||||
| DataScale | varchar(20) | NO | log2 |
ProbeSetSE
Comment:
Contains standard error of assays in ProbeSetData. Roughly 0.5 billion rows as of March 2016. Human data do not have error terms usually.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| DataId | int(10) unsigned | NO | PRI | 0 | |||
| StrainId | int(20) | NO | PRI | ||||
| error | float | YES |
ProbeSetXRef
Comment:
This table contains summary data used by the Advanced Search feature in GN1 and GN2 (e.g "mean=(6 20)", for a particular data sets, including information on average expression of probe sets and probes, phenotypes, LRS values of single best QTL, p values of single best QTL, additive effect of single best QTL, locus ID of the marker closest to the single best QTL, etc.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| ProbeSetFreezeId | smallint(5) unsigned | NO | MUL | 0 | |||
| ProbeSetId | int(10) unsigned | NO | MUL | 0 | |||
| DataId | int(10) unsigned | NO | PRI | 0 | |||
| Locus_old | char(20) | YES | |||||
| LRS_old | double | YES | |||||
| pValue_old | double | YES | |||||
| mean | double | YES | average expression across data set for a particular probe set | ||||
| se | double | YES | range of expression (not actually SE) across data set for a particular probe set | ||||
| Locus | varchar(50) | YES | MUL | locus or marker closest to highest QTL peak | |||
| LRS | double | YES | LRS from QTL Reaper of highest QTL peak | ||||
| pValue | double | YES | p value based on QTL Reaper of highest QTL peak | ||||
| additive | double | YES | additive effect size from QTL Reaper at highest QTL peak | ||||
| h2 | float | YES |
ProbeSetXRef_old
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| ProbeSetFreezeId | smallint(5) unsigned | NO | PRI | 0 | |||
| ProbeSetId | int(10) unsigned | NO | PRI | 0 | |||
| DataId | int(10) unsigned | NO | UNI | 0 | |||
| Locus_old | char(20) | YES | |||||
| LRS_old | double | YES | |||||
| pValue_old | double | YES | |||||
| mean | double | YES | |||||
| se | double | YES | |||||
| Locus | varchar(50) | YES | MUL | ||||
| LRS | double | YES | |||||
| pValue | double | YES | |||||
| additive | double | YES | |||||
| h2 | float | YES |
ProbeXRef
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| ProbeFreezeId | smallint(5) unsigned | NO | PRI | 0 | |||
| ProbeId | int(10) unsigned | NO | PRI | 0 | |||
| DataId | int(10) unsigned | NO | UNI | 0 |
Publication
Comment:
Used by Phenotypes data sets. Each published phenotype is associated with a PubMed ID. All data should ideally be populated automatically from PubMed rather entered by users.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(10) | NO | PRI | auto_increment | |||
| PubMed_ID | int(10) unsigned | YES | UNI | ||||
| Abstract | mediumtext | YES | |||||
| Authors | mediumtext | NO | |||||
| Title | varchar(255) | YES | MUL | ||||
| Journal | varchar(255) | YES | |||||
| Volume | varchar(255) | YES | |||||
| Pages | varchar(255) | YES | |||||
| Month | varchar(255) | YES | |||||
| Year | varchar(255) | NO | 0 |
Publication_Test
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | |||
| PubMed_ID | int(10) unsigned | YES | UNI | ||||
| Abstract | mediumtext | YES | |||||
| Authors | mediumtext | NO | |||||
| Title | varchar(255) | YES | |||||
| Journal | varchar(255) | YES | |||||
| Volume | varchar(255) | YES | |||||
| Pages | varchar(255) | YES | |||||
| Month | varchar(255) | YES | |||||
| Year | varchar(255) | NO | 0 |
PublishData
Comment:
Data on phenotypes. Equivalent roughly to ProbeSetData. 1 million records as of March 2016. Much of these data are actually not published yet.
This is really "StandardPhenotypeData". Currently also includes some metagenomic data.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(10) unsigned | NO | PRI | 0 | |||
| StrainId | int(20) | NO | PRI | ||||
| value | float(14,6) | YES |
PublishFreeze
Comment:
This is a table of cohorts/populations that have associated Phenotype data in the "Type" menu of the GN "Select and Search" page. As of March 2016 this table has 34 rows corresponding to 34 Published Phenotype data sets for different groups. When we enter a new group (cohort or population or RI set) that will have phenotypes into GeneNetwork, then we need to add data to this table. Be careful, when you add a new "PublishFreeze.Name" here then you must also make sure that the Group name (e.g. "BXD" in the "InbredSet" table) exactly matches the first part of the PublishFreeze.Name" or else the code will generate an error.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | Unique integer. Just an integer that unique specifies one of the Published Phenotype data sets. 1 = BXDPublish, 34 = HSNIHPPublish | ||
| Name | varchar(100) | NO | Must be unique. This is the name of the Published (and unpublished) data associated with a cohort or population. The name here (example "BXDPublish") must match a specific cohort name (e.g. "BXD", also known as an "InbredSet" name). | ||||
| FullName | varchar(100) | NO | This is the long name that goes into the menu. Order is not controlled yet but this could be added. | ||||
| ShortName | varchar(100) | NO | |||||
| CreateTime | date | NO | 2001-01-01 | ||||
| public | tinyint(4) | NO | 0 | ||||
| InbredSetId | smallint(5) unsigned | YES | 1 | ||||
| confidentiality | tinyint(3) | YES | 0 | ||||
| AuthorisedUsers | varchar(100) | YES |
PublishSE
Comment:
Table contains the standard error of the phenotype value.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| DataId | int(10) unsigned | NO | PRI | 0 | |||
| StrainId | int(20) | NO | PRI | ||||
| error | float | NO |
PublishXRef
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(10) unsigned | NO | PRI | ||||
| InbredSetId | smallint(5) unsigned | NO | PRI | 0 | |||
| PhenotypeId | smallint(5) unsigned | NO | UNI | 0 | |||
| PublicationId | smallint(5) unsigned | NO | 0 | ||||
| DataId | int(10) unsigned | NO | UNI | 0 | |||
| mean | double | YES | |||||
| Locus | char(50) | YES | MUL | ||||
| LRS | double | YES | |||||
| additive | double | YES | |||||
| Sequence | smallint(5) unsigned | NO | 1 | ||||
| comments | mediumtext | NO |
RatSnpPattern
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(12) | NO | PRI | auto_increment | |||
| SnpId | int(12) | NO | UNI | ||||
| BN | char(1) | YES | |||||
| F344 | char(1) | YES | |||||
| ACI | char(1) | YES | |||||
| BBDP | char(1) | YES | |||||
| FHH | char(1) | YES | |||||
| FHL | char(1) | YES | |||||
| GK | char(1) | YES | |||||
| LE | char(1) | YES | |||||
| LEW | char(1) | YES | |||||
| LH | char(1) | YES | |||||
| LL | char(1) | YES | |||||
| LN | char(1) | YES | |||||
| MHS | char(1) | YES | |||||
| MNS | char(1) | YES | |||||
| SBH | char(1) | YES | |||||
| SBN | char(1) | YES | |||||
| SHR | char(1) | YES | |||||
| SHRSP | char(1) | YES | |||||
| SR | char(1) | YES | |||||
| SS | char(1) | YES | |||||
| WAG | char(1) | YES | |||||
| WLI | char(1) | YES | |||||
| WMI | char(1) | YES | |||||
| WKY | char(1) | YES | |||||
| ACI_N | char(1) | YES | |||||
| BN_N | char(1) | YES | |||||
| BUF_N | char(1) | YES | |||||
| F344_N | char(1) | YES | |||||
| M520_N | char(1) | YES | |||||
| MR_N | char(1) | YES | |||||
| WKY_N | char(1) | YES | |||||
| WN_N | char(1) | YES |
Sample
Comment:
DEPRECATED. Only used in GN1 between 2004 and about 2006 to display images of microarray data.
A table that provides access to low-level array data in GeneNetwork. This table is used only from tables embedded in INFO files such as http://www.genenetwork.org/dbdoc/BR_U_1203_MR.html. The table will call an Image URL and CEL file URL, a DAT file URL, etc. This format and table has not been used since about 2005. We should develop a better method to allow access to raw data from GN.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | |||
| StrainId | smallint(5) unsigned | NO | MUL | 0 | |||
| Name | varchar(30) | YES | |||||
| Age | smallint(6) | NO | 0 | ||||
| Sex | enum('F','M') | NO | F | ||||
| CreateTime | date | NO | 2001-01-01 | ||||
| TissueType | varchar(30) | YES | |||||
| FromSrc | varchar(10) | YES | |||||
| ImageURL | varchar(100) | YES | |||||
| CELURL | varchar(120) | YES | |||||
| DATURL | varchar(100) | YES | |||||
| CHPURL | varchar(100) | YES | |||||
| RPTURL | varchar(100) | YES | |||||
| EXPURL | varchar(100) | YES | |||||
| TXTURL | varchar(100) | YES |
SampleXRef
Comment:
DEPRECATED. Used only in GN1 from 2004 to 2006 to display CEL files and array scan images for QC.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| SampleId | smallint(5) unsigned | NO | PRI | 0 | |||
| ProbeFreezeId | smallint(5) unsigned | NO | PRI | 0 |
SnpAll
Comment:
CHECK, UPDATE or DELETE. Antique data that may be used by SNP Browser or by SNP displays in GN1 maps (single chromosome views). Probably only data for mouse in the table although structured for other species too.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(20) unsigned | NO | PRI | auto_increment | |||
| SpeciesId | smallint(5) unsigned | YES | 1 | ||||
| SnpName | char(30) | YES | MUL | ||||
| Rs | char(30) | YES | MUL | ||||
| Chromosome | char(2) | YES | MUL | ||||
| Position | double | YES | |||||
| Position_2016 | double | YES | |||||
| Alleles | char(5) | YES | |||||
| Source | char(35) | YES | MUL | ||||
| ConservationScore | double | YES | |||||
| 3Prime_UTR | mediumtext | YES | |||||
| 5Prime_UTR | mediumtext | YES | |||||
| Upstream | mediumtext | YES | |||||
| Downstream | mediumtext | YES | |||||
| Intron | char(1) | YES | |||||
| Non_Splice_Site | mediumtext | YES | |||||
| Splice_Site | mediumtext | YES | |||||
| Intergenic | char(1) | YES | |||||
| Exon | char(1) | YES | |||||
| Non_Synonymous_Coding | mediumtext | YES | |||||
| Synonymous_Coding | mediumtext | YES | |||||
| Start_Gained | mediumtext | YES | |||||
| Start_Lost | mediumtext | YES | |||||
| Stop_Gained | mediumtext | YES | |||||
| Stop_Lost | mediumtext | YES | |||||
| Unknown_Effect_In_Exon | mediumtext | YES | |||||
| Domain | varchar(50) | YES | |||||
| Gene | varchar(30) | YES | |||||
| Transcript | varchar(50) | YES |
SnpAllRat
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(20) | NO | PRI | auto_increment | |||
| SpeciesId | int(5) | YES | 2 | ||||
| SnpName | char(30) | YES | MUL | ||||
| Chromosome | char(2) | YES | MUL | ||||
| Position | double | YES | |||||
| Alleles | char(5) | YES | |||||
| Source | char(35) | YES | MUL | ||||
| ConservationScore | double | YES | |||||
| Domain | varchar(50) | YES | |||||
| Gene | varchar(30) | YES | |||||
| Transcript | varchar(50) | YES | |||||
| Function | varchar(50) | YES |
SnpAllele_to_be_deleted
Comment:
OK, delete this then. (RWW March 2016)
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | |||
| Base | char(20) | YES | |||||
| Info | char(255) | YES |
SnpPattern
Comment:
Data used by SNP Browser. Variant browser needs to be redone from scratch using a decent architecture. 80 million SNPs in this table from sequence data of 2011 (Keane et al. Nature) but imputed to many other strains.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| SnpId | int(10) unsigned | NO | PRI | 0 | |||
| 129P2/OlaHsd | char(1) | YES | |||||
| 129S1/SvImJ | char(1) | YES | |||||
| 129S5/SvEvBrd | char(1) | YES | |||||
| AKR/J | char(1) | YES | |||||
| A/J | char(1) | YES | |||||
| BALB/cJ | char(1) | YES | |||||
| C3H/HeJ | char(1) | YES | |||||
| C57BL/6J | char(1) | YES | |||||
| CAST/EiJ | char(1) | YES | |||||
| CBA/J | char(1) | YES | |||||
| DBA/2J | char(1) | YES | |||||
| LP/J | char(1) | YES | |||||
| NOD/ShiLtJ | char(1) | YES | |||||
| NZO/HlLtJ | char(1) | YES | |||||
| PWK/PhJ | char(1) | YES | |||||
| SPRET/EiJ | char(1) | YES | |||||
| WSB/EiJ | char(1) | YES | |||||
| PWD/PhJ | char(1) | YES | |||||
| SJL/J | char(1) | YES | |||||
| NZL/LtJ | char(1) | YES | |||||
| CZECHII/EiJ | char(1) | YES | |||||
| CALB/RkJ | char(1) | YES | |||||
| ST/bJ | char(1) | YES | |||||
| ISS/IbgTejJ | char(1) | YES | |||||
| C57L/J | char(1) | YES | |||||
| Qsi5 | char(1) | YES | |||||
| B6A6_Esline_Regeneron | char(1) | YES | |||||
| 129T2/SvEmsJ | char(1) | YES | |||||
| BALB/cByJ | char(1) | YES | |||||
| NZB/BlNJ | char(1) | YES | |||||
| P/J | char(1) | YES | |||||
| I/LnJ | char(1) | YES | |||||
| PERC/EiJ | char(1) | YES | |||||
| TALLYHO/JngJ | char(1) | YES | |||||
| CE/J | char(1) | YES | |||||
| MRL/MpJ | char(1) | YES | |||||
| PERA/EiJ | char(1) | YES | |||||
| IS/CamRkJ | char(1) | YES | |||||
| ZALENDE/EiJ | char(1) | YES | |||||
| Fline | char(1) | YES | |||||
| BTBRT<+>tf/J | char(1) | YES | |||||
| O20 | char(1) | YES | |||||
| C58/J | char(1) | YES | |||||
| BPH/2J | char(1) | YES | |||||
| DDK/Pas | char(1) | YES | |||||
| C57BL/6NHsd | char(1) | YES | |||||
| C57BL/6NTac | char(1) | YES | |||||
| 129S4/SvJae | char(1) | YES | |||||
| BPL/1J | char(1) | YES | |||||
| BPN/3J | char(1) | YES | |||||
| PL/J | char(1) | YES | |||||
| DBA/1J | char(1) | YES | |||||
| MSM/Ms | char(1) | YES | |||||
| MA/MyJ | char(1) | YES | |||||
| NZW/LacJ | char(1) | YES | |||||
| C57BL/10J | char(1) | YES | |||||
| C57BL/6ByJ | char(1) | YES | |||||
| RF/J | char(1) | YES | |||||
| C57BR/cdJ | char(1) | YES | |||||
| 129S6/SvEv | char(1) | YES | |||||
| MAI/Pas | char(1) | YES | |||||
| RIIIS/J | char(1) | YES | |||||
| C57BL/6NNIH | char(1) | YES | |||||
| FVB/NJ | char(1) | YES | |||||
| SEG/Pas | char(1) | YES | |||||
| MOLF/EiJ | char(1) | YES | |||||
| C3HeB/FeJ | char(1) | YES | |||||
| Lline | char(1) | YES | |||||
| SKIVE/EiJ | char(1) | YES | |||||
| C57BL/6NCrl | char(1) | YES | |||||
| KK/HlJ | char(1) | YES | |||||
| LG/J | char(1) | YES | |||||
| C57BLKS/J | char(1) | YES | |||||
| SM/J | char(1) | YES | |||||
| NOR/LtJ | char(1) | YES | |||||
| ILS/IbgTejJ | char(1) | YES | |||||
| C57BL/6JOlaHsd | char(1) | YES | |||||
| SWR/J | char(1) | YES | |||||
| C57BL/6JBomTac | char(1) | YES | |||||
| SOD1/EiJ | char(1) | YES | |||||
| NON/LtJ | char(1) | YES | |||||
| JF1/Ms | char(1) | YES | |||||
| 129X1/SvJ | char(1) | YES | |||||
| C2T1_Esline_Nagy | char(1) | YES | |||||
| C57BL/6NJ | char(1) | YES | |||||
| LEWES/EiJ | char(1) | YES | |||||
| RBA/DnJ | char(1) | YES | |||||
| DDY/JclSidSeyFrkJ | char(1) | YES | |||||
| SEA/GnJ | char(1) | YES | |||||
| C57BL/6JCrl | char(1) | YES | |||||
| EL/SuzSeyFrkJ | char(1) | YES | |||||
| HTG/GoSfSnJ | char(1) | YES | |||||
| 129S2/SvHsd | char(1) | YES | |||||
| MOLG/DnJ | char(1) | YES | |||||
| BUB/BnJ | char(1) | YES |
SnpSource
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | |||
| Name | char(35) | YES | |||||
| DateCreated | date | YES | |||||
| DateAdded | date | YES |
Species
Comment:
Contains the internal Ids and names for various species.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | internal GeneNetwork species identifier | ||
| SpeciesId | int(5) | YES | |||||
| SpeciesName | varchar(50) | YES | |||||
| Name | char(30) | NO | MUL | the common name of the species | |||
| MenuName | char(50) | YES | |||||
| FullName | char(100) | NO | |||||
| Family | varchar(50) | YES | |||||
| FamilyOrderId | smallint(6) | YES | |||||
| TaxonomyId | int(11) | YES | |||||
| OrderId | smallint(6) | YES |
Strain
Comment:
RENAME "SubjectDescription" . This table to keep track of case/subject identifiers (cases or F2 or strains). But we have the problem that there may be multiple observation per subject or the time series data for one case, (multiple ages for one strain, etc). Generic sample/case identifiers here.
Contains 14,000 rows as of March 2016. We really need a new table "ObservationOfSubject" (RWW 2016)
Apurva would like to extend this table to include "DateOfBirth" and "BatchNumber".
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(20) | NO | PRI | auto_increment | GN internal identifier for the strain | ||
| Name | varchar(100) | YES | MUL | official strain name/symbol | |||
| Name2 | varchar(100) | YES | |||||
| SpeciesId | smallint(5) unsigned | NO | 0 | Species:Id | species of strain | ||
| Symbol | varchar(20) | YES | MUL | short strain symbol used in graphs and tables | |||
| Alias | varchar(255) | YES |
StrainXRef
Comment:
RENAME something like "SubjectXRef". This table links the information in the Strain table with InbredSet and provides order for the strains in the mapping population.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| InbredSetId | smallint(5) unsigned | NO | PRI | 0 | InbredSet:Id | The Id of the mapping population in the InbredSet table. | |
| StrainId | int(20) | NO | PRI | Strain:Id | The Id of the mapping population strain in Strain table. | ||
| OrderId | int(20) | YES | Order of the strains in the Genotype file or mapping population, follows the pattern 10, 20 rather than 1,2. | ||||
| Used_for_mapping | char(1) | YES | N | ||||
| PedigreeStatus | varchar(255) | YES |
Tissue
Comment:
(RWW Nov 2007): A small table that may be used to build pull-down menus in GN1 and GN2. This table contains simple one to three word terms describing the tissue, cell, organ, or other biological material used in the microarray experiment. This table is used in conjunction with the FIND RECORDS "Type" field.
As of Nov 2007 this table contained only 15 rows:
As of Mar 2016 this table contains 158 rows.
Whole Brain
Cerebellum
Hematopoietic Cells
Liver
etc.
How is this table used? Probably to create menu fields. Talk with Chris Mungall and colleagues about controlled vocabulary for APIs.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | Incremented integer uniquely identifies the record. | ||
| TissueId | int(5) | YES | |||||
| TissueName | varchar(50) | YES | |||||
| Name | char(50) | YES | UNI | Name of the biological material used in the experiment. | |||
| Short_Name | char(30) | NO | UNI | ||||
| BIRN_lex_ID | char(30) | YES | Need to get official IDs for tissues, cells, etc. | ||||
| BIRN_lex_Name | char(30) | YES | Need to get official IDs for tissues, cells, etc. |
TissueProbeFreeze
Comment:
These 'Tissue' tables are used by the Tissue Correlation tool in GN1. Not implemented yet in GN2.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | |||
| ChipId | smallint(5) unsigned | NO | 0 | ||||
| StrainId | varchar(100) | NO | 0 | ||||
| Name | varchar(100) | NO | UNI | ||||
| FullName | varchar(100) | NO | UNI | ||||
| ShortName | varchar(100) | NO | |||||
| CreateTime | date | NO | 0000-00-00 | ||||
| InbredSetId | smallint(5) unsigned | YES | 1 |
TissueProbeSetData
Comment:
These 'Tissue' tables are used by the Tissue Correlation tool in GN1. Not implemented yet in GN2. Mainly Illumina Mouse version 6.1 data.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(10) unsigned | NO | PRI | auto_increment | |||
| TissueID | int(10) unsigned | NO | PRI | 0 | |||
| value | float | NO | 0 |
TissueProbeSetFreeze
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | smallint(5) unsigned | NO | PRI | auto_increment | |||
| TissueProbeFreezeId | smallint(5) unsigned | NO | 0 | ||||
| AvgID | smallint(5) unsigned | NO | 0 | ||||
| Name | varchar(40) | YES | UNI | ||||
| Name2 | varchar(100) | NO | MUL | ||||
| FullName | varchar(100) | NO | UNI | ||||
| ShortName | varchar(100) | NO | |||||
| CreateTime | date | NO | 0000-00-00 | ||||
| public | tinyint(4) | NO | 0 | ||||
| confidentiality | tinyint(4) | NO | 0 | ||||
| AuthorisedUsers | varchar(100) | YES |
TissueProbeSetXRef
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| TissueProbeSetFreezeId | smallint(5) unsigned | NO | PRI | 0 | |||
| ProbesetId | int(10) unsigned | NO | PRI | 0 | |||
| DataId | int(10) unsigned | NO | UNI | 0 | |||
| Mean | float | YES | 0 | ||||
| useStatus | char(1) | YES | |||||
| Symbol | varchar(100) | YES | MUL | ||||
| GeneId | varchar(20) | YES | MUL | ||||
| Chr | char(3) | YES | MUL | ||||
| Mb | double | YES | |||||
| Mb_2016 | double | YES | |||||
| description | varchar(255) | YES | |||||
| Probe_Target_Description | varchar(225) | YES |
TraitMetadata
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| type | varchar(255) | YES | |||||
| value | longtext | YES |
UserPrivilege
Comment:
Used to define if an Assay data set (old "ProbeSetFreeze") can be opened and downloaded.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| UserId | int(10) unsigned | NO | MUL | ||||
| ProbeSetFreezeId | smallint(5) unsigned | NO | |||||
| download_result_priv | enum('N','Y') | NO | N |
Vlookup
Comment:
It's been used by Arthur for annotation updates.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(11) | NO | PRI | auto_increment | |||
| VLProbeSetId | mediumtext | YES | |||||
| VLBlatSeq | longtext | YES | |||||
| InfoFileId | int(5) | YES | |||||
| DatasetId | int(5) | YES | |||||
| SpeciesId | int(5) | YES | |||||
| TissueId | int(5) | YES | |||||
| InbredSetId | int(5) | YES | |||||
| GeneChipId | int(5) | YES | |||||
| AvgMethodId | int(5) | YES | |||||
| InfoPageName | varchar(255) | YES | |||||
| GN_AccesionId | int(5) | YES | |||||
| Name | varchar(100) | YES | |||||
| GeneId | varchar(10) | YES | |||||
| Mb | double | YES | |||||
| Chr | varchar(10) | YES | |||||
| Probe_set_Blat_Mb_start | double | YES | |||||
| Probe_set_Blat_Mb_end | double | YES | |||||
| Strand | char(1) | YES | |||||
| TxStart | double | YES | |||||
| TxEnd | double | YES | |||||
| cdsStart | double | YES | |||||
| cdsEnd | double | YES | |||||
| exonCount | int(7) | YES | |||||
| exonStarts | mediumtext | YES | |||||
| exonEnds | mediumtext | YES | |||||
| ProteinID | varchar(15) | YES | |||||
| AlignID | varchar(10) | YES | |||||
| kgID | varchar(10) | YES | |||||
| NM_ID | varchar(15) | YES | |||||
| SnpName | char(30) | YES | |||||
| Position | double | YES | |||||
| HMDB_ID | varchar(255) | YES | |||||
| Symbol | varchar(100) | YES | |||||
| description | longtext | YES | |||||
| alias | longtext | YES | |||||
| Full_Description | longtext | YES | |||||
| BlatSeq | mediumtext | YES | |||||
| ChEBI_ID | int(10) | YES | |||||
| ChEMBL_ID | varchar(100) | YES | |||||
| CAS_number | varchar(100) | YES | |||||
| PubChem_ID | int(10) | YES | |||||
| ChemSpider_ID | varchar(10) | YES | |||||
| UNII_ID | varchar(100) | YES | |||||
| EC_number | varchar(100) | YES | |||||
| KEGG_ID | varchar(100) | YES | |||||
| Molecular_Weight | varchar(100) | YES | |||||
| Nugowiki_ID | varchar(100) | YES | |||||
| assembly | varchar(10) | YES |
caseattributes_audit
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | int(11) | NO | PRI | auto_increment | |||
| status | enum('review','rejected','approved') | NO | |||||
| editor | varchar(255) | NO | |||||
| json_diff_data | varchar(2048) | NO | |||||
| time_stamp | timestamp | NO | current_timestamp() |
login
Comment:
Used by GN2. Just a login file. 277 login in GN2 as of March 2016.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | varchar(36) | NO | PRI | ||||
| user | varchar(36) | YES | MUL | ||||
| timestamp | datetime | YES | |||||
| ip_address | varchar(39) | YES | |||||
| successful | tinyint(1) | NO | |||||
| session_id | text | YES | |||||
| assumed_by | varchar(36) | YES | MUL |
metadata_audit
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | int(11) | NO | PRI | auto_increment | |||
| dataset_id | int(11) | NO | |||||
| editor | varchar(255) | NO | |||||
| json_diff_data | longtext | YES | |||||
| time_stamp | timestamp | NO | current_timestamp() |
mytest1
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| Id | int(10) unsigned | NO | PRI | 0 | |||
| StrainId | mediumint(8) unsigned | NO | PRI | 0 | |||
| value | float | NO |
pubmedsearch
Comment:
Data table used to find gene symbols associated with authors. Created by Lei Yan for Author search functions in GN1. Check if this works in GN2. This function has alrways been a bit flaky.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | bigint(20) | NO | PRI | auto_increment | |||
| pubmedid | bigint(20) | YES | |||||
| title | mediumtext | YES | |||||
| authorfullname | mediumtext | YES | MUL | ||||
| authorshortname | mediumtext | YES | |||||
| institute | mediumtext | YES | MUL | ||||
| geneid | varchar(20) | YES | MUL |
role
Comment:
Noble intent table. Can be deleted or implemented. Idea was "administrator", "curator", "owner", "user"
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| the_id | varchar(36) | NO | PRI | ||||
| name | varchar(80) | NO | UNI | ||||
| description | varchar(255) | YES |
roles_users
Comment:
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| user_id | int(11) | YES | MUL | ||||
| role_id | int(11) | YES | MUL |
temporary
Comment:
This is probably the content of the user's collection. Lost at end of user's session.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| tax_id | varchar(20) | YES | |||||
| GeneID | varchar(20) | YES | |||||
| Symbol | varchar(100) | YES | |||||
| OMIM | varchar(100) | YES | |||||
| HomoloGene | varchar(100) | YES | |||||
| Other_GeneID | varchar(20) | YES |
user
Comment:
GN2 only.
Comment on User type and password.
This table has 47 users in GN2 as of Mar 2016.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | varchar(36) | NO | PRI | ||||
| email_address | varchar(50) | NO | UNI | ||||
| password | text | NO | this is a hash value of user's password | ||||
| full_name | varchar(50) | YES | |||||
| organization | varchar(50) | YES | |||||
| active | tinyint(1) | NO | |||||
| registration_info | text | YES | |||||
| confirmed | text | YES | |||||
| superuser | text | YES |
user_collection
Comment:
GN2 user collection of traits.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| id | varchar(36) | NO | PRI | ||||
| user | varchar(36) | YES | MUL | ||||
| name | text | YES | |||||
| created_timestamp | datetime | YES | |||||
| changed_timestamp | datetime | YES | |||||
| members | text | YES |
user_openids
Comment:
TO BE IMPLEMENTED (maybe). Table to link to OpenID. Probably not needed.
| Field | Type | Null | Key | Default | Extra | Foreign_Key | Annotation |
|---|---|---|---|---|---|---|---|
| openid_url | varchar(255) | NO | PRI | ||||
| user_id | varchar(36) | NO | MUL |
|
Web services initiated January, 1994 as Portable Dictionary of the Mouse Genome; June 15, 2001 as WebQTL; and Jan 5, 2005 as GeneNetwork. This site is currently operated by Rob Williams, Pjotr Prins, Zachary Sloan, Arthur Centeno. Design and code by Pjotr Prins, Zach Sloan, Arthur Centeno, Danny Arends, Christian Fischer, Sam Ockman, Lei Yan, Xiaodong Zhou, Christian Fernandez, Ning Liu, Rudi Alberts, Elissa Chesler, Sujoy Roy, Evan G. Williams, Alexander G. Williams, Kenneth Manly, Jintao Wang, and Robert W. Williams, colleagues. |
|
|
GeneNetwork support from:
|
|||
| It took 0.223 second(s) for tux01.uthsc.edu to generate this page | |||